Inhibitor of DNA Binding 1 Activates Vascular Endothelial Growth Factor through Enhancing the Stability and Activity of Hypoxia-Inducible Factor-1A

Inhibitor of DNA binding 1 (Id-1) has been implicated in tumor angiogenesis by regulating the expression of vascular endothelial growth factor (VEGF), but its molecularmechanismhasnotbeen fully understood.Here, weshow the cross talk between Id-1 and hypoxia-inducible factor-1A (HIF-1A), that Id-1 induces VEGF by enhancing the stability and activity of HIF-1A in human endothelial and breast cancer cells. Although both the transcript and proteins levels of VEGF were induced by Id-1, only the protein expression of HIF-1A was induced without transcriptional changes in both human umbilical endothelial cells and MCF7 breast cancer cells. Such induction of the HIF-1A protein did not require de novo protein synthesis but was dependent on the active extracellular response kinase (ERK) pathway. In addition, stability of the HIF-1A protein was enhanced in part by the reduced association of the HIF-1A protein with von Hippel-Lindau protein in the presence of Id-1. Furthermore, Id-1 enhanced nuclear translocation and the transcriptional activity of HIF-1A. Transcriptional activation of HIF-1–dependent promoters was dependent on the active ERK pathway, and the association of HIF-1A protein with cyclic AMP-responsive element binding protein was enhanced by Id-1. Finally, Id-1 induced tube formation in human umbilical endothelial cells, which also required active ERK signaling. In conclusion, we provide the molecular mechanism of the cross talk between HIF-1A and Id-1, which may play a critical role in tumor angiogenesis. (Mol Cancer Res 2007;5(4):321–9) Introduction Angiogenesis is a highly complex and coordinated process regulated by a number of proangiogenic and antiangiogenic molecules, and there is consensus that vascular endothelial growth factor (VEGF) signaling is critical during tumor progression (1). VEGF induces angiogenesis by inducing proliferation, differentiation, and chemotaxis of endothelial cells (2, 3). VEGF expression can be induced by hypoxia, and it is well established that the transcription factor hypoxia-inducible factor 1 (HIF-1) is a key mediator of such response (4, 5). HIF-1 is a heterodimeric complex composed of inducible HIF-1a and constitutive HIF-1h subunits. In contrast to HIF-1h, oxygen levels regulate both the expression and activity ofHIF-1a. At normoxia, HIF-1a is rapidly ubiquitylated and degraded by the 26S proteasome, whereas at hypoxia, the protein is stabilized (6). Degradation of HIF-1a is regulated by hydroxylation of specific proline residues that are recognized by the von Hippel-Lindau (VHL) tumor suppressor protein, which is part of an E3 ubiquitin ligase complex (7, 8). At low oxygen levels, HIF-1a translocates to the nucleus (9), where the functionally active HIF-1a/HIF-1h complex activates transcription of target genes by binding to cognate hypoxia-responsive elements (HRE) and by recruiting coactivators, such as p300/ cyclic AMP-responsive element binding protein–binding protein (CBP), and factors belonging to the SRC/p160 family of proteins (10-13). In addition to hypoxia, a growing number of hormonal, environmental, and intracellular stimuli aswell as posttranslational modifications have been reported to regulate the stability and/or activity of HIF-1a protein (14-25). Inhibitor of DNA binding 1 (Id-1) is a member of the Id protein family that is implicated in the regulation of cellular differentiation, cell cycle progression, senescence, and apoptosis (26). Evidence also suggests that Id proteins may be key regulators of oncogenic transformation and tumor progression in a subset of tumor types (reviewed in ref. 27). In tumor angiogenesis, the roles of Id-1 have been shown mainly in two different cell types: endothelial cells and tumor cells. The crucial role of endothelial Id protein in tumor angiogenesis was initially reported from xenograft studies in Id-1 / Id-3 mice (28). Xenograft tumors in Id-1 / Id-3 mice either fail to grow completely or show slower growth with extensive hemorrhage and necrosis. However, transplantation of wild-type bone marrow–derived endothelial precursor cells restores tumor angiogenesis and growth in Id-1 / Id-3 host (29). In spontaneous tumors that arise in the Id-1 / Id-3 background, the consequence of angiogenesis inhibition by Id loss varies in severity depending on the tumor type (26, 30-32). Despite more variability in their dependence on bone marrow– derived endothelial precursor cells than xenografts, the importance of endothelial Id expression on tumor angiogenesis have been recognized. The critical role of Id-1 proteins in Received 7/20/06; revised 1/29/07; accepted 2/6/07. Grant support: Korea Science and Engineering Foundation through the Science Research Center-Molecular Therapy Research Center (G. Kong). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Note: H-J. Kim and H. Chung equally contributed to this work. Requests for reprints: Gu Kong, Department of Pathology, College of Medicine, Hanyang University, 17 Haengdang-dong, Seongdong-gu, Seoul, 133-791, Republic of Korea. Phone: 82-2-2290-8251; Fax: 82-2-2295-1091. E-mail: [email protected] Copyright D 2007 American Association for Cancer Research. doi:10.1158/1541-7786.MCR-06-0218 Mol Cancer Res 2007;5(4). April 2007 321 on July 8, 2017. © 2007 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from angiogenic processes have also been reported in human endothelial cells. Induction of Id-1 and Id-3 proteins is seen in VEGF-induced human umbilical endothelial cells (HUVEC; ref. 33). In addition, transplantation of Id-1– transfected HUVECs augments therapeutic angiogenesis in murine hind limb ischemia model (34). At the molecular level, Id-1 is reported as a downstream mediator of bone morphogenetic protein and proangiogenic fluvastatin (35-38). Despite numerous reports of Id-1 overexpression in various primary tumors (reviewed by ref. 27), the correlation between Id-1 overexpression and tumor angiogenesis is reported only in primary human pancreas cancers (39), estrogen receptor– negative and node-positive subtype of invasive ductal breast carcinoma (40), and hepatocellular carcinoma (41). Although not limited to its role in tumor angiogenesis, Id-1 is identified as one of the lung metastasis signature genes, and targeting Id-1 and Id3 by RNA interference inhibits peritoneal metastasis of gastric cancer (42, 43). Chemicals such as 1a,25-dihydroxyvitamin D3 activates Id-1 promoter in human colon carcinoma cell line, whereas 2-methoxyestradiol down-regulates Id-1 expression in mammary tumor and endothelial cells (44, 45). In addition, rastransformed murine fibrosarcoma cells release soluble mediators that can induce thrombospondin-1 down-regulation in adjacent nontransformed, normal dermal fibroblasts, where Id-1 gene expression is required for paracrine thrombospondin-1 downregulation (46). Furthermore, overexpression of Id-1 in prostate cancer cells is reported to promote angiogenesis by inducing VEGF expression (47). In this study, we examined the role of Id-1 overexpression in breast cancer cell line MCF7. We report that Id-1 induced VEGF expression by enhancing the stability, nuclear translocation, and activity of HIF-1a protein, and the activation of the extracellular response kinase (ERK) pathway was required for these processes. Results Id-1 Enhances HIF-1a Protein Expression in Human Endothelial Cells As Id-1 is reported to induce angiogenic effect on HUVECs by inducing VEGF expression at the transcriptional level (47), we examined the effect of Id-1 on the expression of HIF-1a, a potent regulator of VEGF transcription. The protein and transcript levels of VEGF were higher in Id-1–overexpressing cells (Fig. 1A-C), which is in agreement with the previous report of Ling et al. (46). In the same control cells, high level of HIF-1a protein expression was seen under hypoxia than normoxia (Fig. 1A, lane 1 versus 3). Interestingly, the protein levels of HIF-1a were also augmented by Id-1 in both hypoxic and normoxic conditions (Fig. 1A, lane 2 versus 1 and lane 4 versus 3; Fig. 1D, gray columns), but the mRNA level remained constant (Fig. 1B and D, black columns). Because HIF-1a expression remained constant at the mRNA level but was induced only at the protein level, the effect of Id-1 on HIF1a expression is likely to occur at the posttranscriptional level. Such result implies the possible role of Id-1 in enhancing the protein stability of HIF-1a protein. Id-1 Induces VEGF and HIF-1a Expression in Human Breast Cancer Cell Line MCF7 The expression of angiogenic regulators upon Id-1 overexpression was examined in MCF7 cells. Augmented VEGF expression at both mRNA (Fig. 2A) and protein (Fig. 2B) levels was observed in Id-1–overexpressing MCF7 cells. In addition, the protein level of HIF-1a was significantly augmented by Id-1 (Fig. 2B), but the mRNA level remained constant (Fig. 2A). Intriguingly, HIF-1a protein was induced by Id-1 in normoxia, which is known to cause rapid degradation of HIF-1a protein (6). Id-1 gave augmented HIF-1a only at the protein level, again suggesting the role of Id-1 in enhancing the stability of HIF-1a protein. Id-1–Induced HIF-1a Is Not due to Enhanced Protein Synthesis Because the level of HIF-1a protein is determined by the rates of protein synthesis and protein degradation (48), we tested whether Id-1 affected the protein synthesis of HIF-1a. The endogenous HIF-1a protein decreased upon treatment with the protein synthesis inhibitor cycloheximide in the absence of Id-1 overexpression (Fig. 2C, lanes 1-3). However, in CoCl2-treated samples that mimics hypoxia, HIF-1a protein level was augmented and remained constant even in the presence of FIGURE 1. Id-1 regulates the expression of angiogenic regulators in HUVECs. HUVECs were infected with EGFP alone– (Control ) or EGFP and Id-1-HA (Id-1 ) –expressing retrovirus for 48 h. Cells were incubated under either hypoxic (Hypoxia ) or normoxic (Normoxia) condition. At 48 h after infection, cells were harvested and subjected to total RNA extraction and cell lysis. A. Fifty micrograms of cell lysates were analyzed for expression of the indicated proteins by immunoblotting. B. Reverse transcription-PCR (RT-PCR) was done to quantify the expression of the indicated transcripts as described in Materials and Methods. Results in (A) and (B) were from a single representative experiment of three independent experiments with similar results. Anti-Id-1 (Id-1 ) and antih-actin (b-actin ) immunoblots were from an identical membrane and cut and probed separately for indicated antibodies, whereas anti-VEGF (VEGF ) and anti-HIF-1a (HIF-1a ) immunoblots were done with separate membranes. VEGF (C) and HIF-1a (D) expression in (A) and (B) were quantified and presented as relative values to those of control under normoxia (Control, Normoxia ): gray columns, immunoblot; black columns, reverse transcription. Columns, average of three independent experiments with similar results; bars, SD. *, P < 0.05; ***, P < 0.001, statistical significance of induction by hypoxia and/or Id-1 (Student’s t test). Kim et al. Mol Cancer Res 2007;5(4). April 2007 322 on July 8, 2017. © 2007 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from cycloheximide (Fig. 2C, lanes 4-6). Similarly, in the presence of Id-1 overexpression, HIF-1a protein level was increased and remained unchanged upon cycloheximide treatment (Fig. 2C, lanes 7-9). Such results show that Id-1 did not affect the protein synthesis of HIF-1a. Id-1–Induced HIF-1a Protein Stability Is Dependent on the ERK Signaling Pathway Because the active ERK pathway has been implicated in the stability of HIF-1a protein (19), we examined whether the ERK pathway was affected by Id-1. More phosphorylated forms of ERK were detected (Fig. 3A), indicating that Id-1 activated the ERK signaling pathway in MCF7 cells. However, when the ERK signaling pathway was blocked by PD98059 (49), HIF-1a protein levels were significantly reduced (Fig. 3B). Taken together, the Id-1–induced HIF-1a protein stability requires active ERK signaling, which in turn is activated by Id-1. Id-1 Enhances the HIF-1a Protein Stability through Reduced Association of HIF-1a with VHL As a molecular mechanism by which Id-1 enhances the stabilization of HIF-1a protein, we examined whether Id-1 influenced the association of HIF-1a with the VHL tumor suppressor protein. Under normoxic conditions, oxygendependent hydroxylation of proline residues in HIF-1a is required for the interaction of HIF-1awith VHL, and VHL is the recognition component of an E3 ubiquitin-protein ligase that targets HIF-1a for proteasomal degradation (48). As seen in Fig. 4, very strong VHL-HIF-1a interaction and augmented HIF-1a protein were seen in the presence of the proteasome inhibitor MG132 (lane 3). However, VHL-HIF-1a interaction was significantly reduced, whereas the HIF-1a protein itself was augmented when treated with CoCl2 (Fig. 4, lane 4). Likewise, Id-1 overexpression yielded reduced VHL-HIF-1a interaction despite augmented HIF-1a protein expression (Fig. 4, lane 5). To test the role of the ERK pathway in such settings, we adopted the condition of the Fig. 5 of Yoo et al. (19), where MG132 was added to block the later steps of proteasome-mediated degradation of the HIF-1a protein, especially in the presence of PD98059 (Fig. 4, lane 7 versus 8). Although the amount of HIF-1a–bound VHL seemed restored when compared with that of Myc-VHL– and Id-1-HA–coexpressing cells (Fig. 4, lane 8 versus 5), careful examination of the results with an appropriate control revealed that such restoration was mainly due to the effect of MG132 (Fig. 4, lane 8 versus 6). The effect of MG132 was so overwhelming in terms of Myc-VHL-HIF-1a complex formation (Fig. 4, lanes 3, 6 , and 8) that quantifying the effect of PD98059 was not possible under such experimental settings (Fig. 4, lanes 8 versus 6). Taken together, we conclude that Id-1 can stabilize HIF-1a protein by reducing its association with the VHL protein. FIGURE 2. Id-1 enhances the expression of angiogenic regulators but does not affect HIF-1a protein synthesis in MCF7 cells. Cells were infected with either EGFP alone– (Control ) or EGFP and Id-1-HA (Id-1 ) – expressing adenovirus. Some cells infected with EGFP alone–expressing adenovirus were incubated with 100 Amol/L CoCl2 at 24 h after infection for 24 h (CoCl2 ). At 48 h after infection, cells were harvested and subjected to total RNA extraction (A) or cell lysis (B). Results in (A) and (B) were from a single representative experiment of three independent experiments with similar results. A. Reverse transcription-PCR was done to quantify the expression of the indicated transcripts as described in Materials and Methods. B. Fifty micrograms of cell lysates were analyzed for expression of the indicated proteins by immunoblotting. Anti-Id-1 (Id-1 ) and anti-HIF1a (HIF-1a ) immunoblots were done with separate membranes, whereas anti-VEGF (VEGF ) and anti-h-actin (b-actin ) immunoblots were from an identical membrane and cut and probed separately for indicated antibodies. C. Cells were infected with indicated adenoviruses and incubated with (CoCl2) or without (Control or Id-1 ) CoCl2 as described above. Near the end of incubation, cells were treated with 10 Amol/L cycloheximide (CHX ) for the indicated period to harvest cells simultaneously at 48 h after infection. Fifty micrograms of cell lysates were analyzed for expression of the indicated proteins by immunoblotting. From a single representative experiment of three independent experiments with similar results. AntiHIF-1a (HIF-1a ) immunoblot was done with a separate membrane, whereas anti-Id-1 (Id-1 ) and anti-h-actin (b-actin) immunoblots were from an identical membrane and cut and probed separately for indicated antibodies. FIGURE 3. Id-1 enhances the HIF-1a protein stability by activation of the ERK signaling pathway. A. Fifty micrograms of cell lysates were prepared from MCF7 cells stably expressing pCI-neo vector (Neo ) or pCIneo-Id-1-HA (Id-1 ) and analyzed for expression of the indicated proteins by immunoblotting. P-ERK, immunoblot with anti –phosphorylated ERK1/2 antibody; ERK, immunoblot with anti-ERK1/2 antibody. From a single representative experiment of three independent experiments with similar results. Anti-Id-1 (Id-1 ) and anti –phosphorylated ERKs were from an identical membrane and cut and probed separately for indicated antibodies, whereas HIF-1a (HIF-1a ) immunoblot was done with a separate membrane. Anti-ERKs (ERK ) and anti-h-actin (b-actin ) immunoblots were from an identical membrane, probed first with anti-ERK antibody (ERK ), stripped, and reprobed with anti-h-actin antibody (b-actin ). B. MCF7 cells stably expressing Id-1 were incubated with PD98059 (PD98059 ) at indicated concentrations for 24 h. Fifty micrograms of cell lysates were analyzed for expression of the indicated proteins by immunoblotting. From a single representative experiment of three independent experiments with similar results. Anti-Id-1 (Id-1 ) and anti-ERKs (ERK ) were from an identical membrane and cut and probed separately for indicated antibodies, whereas HIF-1a (HIF-1a ) immunoblot was done with a separate membrane. Anti –phosphorylated ERKs (P-ERK ) and anti-h-actin (bactin) immunoblots were from an identical membrane, probed first with anti –phosphorylated ERK antibody (P-ERK ), stripped, and reprobed with anti-h-actin antibody (b-actin ). Id-1 Enhances Stability and Activity of HIF-1a Mol Cancer Res 2007;5(4). April 2007 323 on July 8, 2017. © 2007 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from Id-1 Enhances the Transcriptional Activity of HIF-1a by Recruiting CBP We next examined whether the stabilized HIF-1a protein by Id-1 was functional. Total HIF-1a protein was induced and localized to the nucleus as seen by immunocytochemistry (Fig. 5). In reporter assays done in MCF7 stable cell lines with two distinct reporter constructs (Fig. 6), both reporter activities were augmented in Id-1–overexpressing cells (lane 8), but such effect was reversed by PD98059 treatment (lane 9). Similar results in a dose-dependent manner were obtained by coexpression of kinase-inactive forms of ERK (lanes 10-13). Although control Neo cells were capable of activating both reporters by CoCl2 (lane 2), inhibition of the ERK pathway resulted in minimal reporter activities (lanes 3-7). From these results, we conclude that Id-1 enhances the transcriptional activity of HIF-1a protein, and that the active ERK pathway is required for such activation. We next tested whether Id-1 augmented the transcriptional activity of HIF-1a by recruiting coactivators. FIGURE 4. Id-1 enhances the HIF-1a protein stability via reduced binding with VHL protein. 293T cells (2 10 per dish) were seeded in 60-cm dishes and incubated overnight. The cells were transfected with 2 Ag pCMV-Myc-VHL (Myc-VHL) and 2 Ag pCI-neo (Id-1 ) or pCI-neo-Id-1-HA (Id-1 +). After 1 h of transfection, cells were incubated with 100 Amol/L CoCl2 or 100 Amol/L PD98059 for 24 h. Near the end of incubation, some cells were treated with 10 Amol/L MG132 (MG132 ) for 1 h to harvest simultaneously at 25 h after transfection. From a single representative experiment of three independent experiments with similar results. Anti-HIF-1a immunoprecipitation (IP ) was done as described in Materials and Methods. The immunoblots (IB ) of the immunoprecipitated samples are from an identical membrane: probed first with anti-HIF-1a antibody (IP: HIF-1a and IB: HIF-1a ), stripped, and reprobed with anti-Myc antibody (IP: HIF-1a and IB: Myc ). Fifty micrograms of whole-cell lysates were analyzed for the expression of the indicated proteins by immunoblotting. The three immunoblots were from the identical lysates shown in the immunoprecipitated blots above: Id-1 was detected from a separate membrane (IB: Id-1 ), whereas the other two blots were from an identical membrane and cut and probed separately for indicated antibodies (IB: Myc and IB: b-actin). FIGURE 5. Id-1 enhances nuclear translocation of HIF-1a. MCF7 cells stably expressing empty pCI-neo vector (Neo ) or pCI-neo-Id-1 (Id-1 ) were subjected to immunocytochemistry as described in Materials and Methods. Some cells were treated for 24 h with 100 Amol/L CoCl2 (Neo + CoCl2 ). One representative of at least three independent experiments with similar results. Kim et al. Mol Cancer Res 2007;5(4). April 2007 324 on July 8, 2017. © 2007 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from Because p300/CBP can bind to HIF-1a and transcriptionally activate HIF-1–mediated gene transcription (10), we quantified the relative amount of CBP-HIF-1a complex by coimmunoprecipitation experiments. As seen in Fig. 7 (top), no binding between CBP and HIF-1a was detected in the absence of Id-1 coexpression (lanes 1 and 2). Similarly, very weak CBP-HIF-1a complex formation was seen despite high HIF-1a expression upon MG132 treatment in the absence of CoCl2 treatment or Id-1 coexpression (lane 4). However, very strong binding between CBP and HIF-1a was seen in CoCl2-treated cells (lane 3), and similar binding was detected in Id-1–overexpressing cells (lane 5). Intriguingly, the amount of VHL-bound HIF-1a was very low in CoCl2-treated (Fig. 7, middle, lane 3) or Id-1–overexpressing (lane 5) cells but significantly higher in the presence ofMF132 (lane 4). Taken together, we conclude that Id1 enhances transcriptional activity of HIF-1a by recruiting CBP. Id-1–Induced Tube Formation in Human Endothelial Cells Requires Active ERK Signaling As tube formation is widely used as an in vitro assay for angiogenesis (50-52), and as Id-1 is reported to induce tube formation in HUVECs (33, 35, 47), we examined the role ERK signaling in Id-1–overexpressing HUVECs. Robust tube formation was observed in Id-1–overexpressing HUVECs under hypoxia condition (Fig. 8A and B, lane 2 versus 1). Intriguingly, Id-1 also gave enhanced tube formation in normoxia as well, although the overall tube formation occurred to a less extent (Fig. 8A and B, lane 5 versus 4). However, such effect of Id-1 was reversed by blocking the ERK signaling pathway with PD98059 (Fig. 8A and B, lane 3 versus 2 and lane 6 versus 5). When one-way ANOVAwas done to examine the group differences, statistical significance was seen between the groups [hypoxia 1-3 : F(2,6) = 179.638, P = 0.000; normoxia 4-6 : F(2,6) = 366.046, P = 0.000]. Upon post hoc test using Scheffe, significant differences between Id-1 (2 and 5) and the other groups (1, 3 and 4, 6) were revealed (the mean differences were significant at the 0.001 level), but not between the control and the Id-1 + PD98059 group. Taken together, we conclude that Id-1– induced tube formation in HUVECs requires active ERK signaling. Discussion Although Id-1 is strongly implicated in tumor angiogenesis, and although numerous cancer cells are reported to overexpress Id-1, there are only a few reports showing the clinical correlation between Id-1 overexpression and tumor angiogenesis. We have previously reported statistically significant correlation between Id-1 overexpression and intratumoral microvessel density in human pancreatic cancers and estrogen receptor–negative/ node-positive breast cancer (39, 40). Based on these findings, we examined the role of Id-1 overexpression in human breast cancer cell lines and its biochemical mechanisms. As a candidate mechanism, we explored the possibility of cross talk between Id-1 and HIF-1a. Even under normoxic conditions, Id-1 gave enhanced HIF-1a protein stability (Figs. 1-3), nuclear translocation (Fig. 5), and transcriptional activity (Fig. 6) in MCF7 cells. We also report that the activated ERK pathway is important for these processes. Induction of the ERK pathway has been reported by Id-1 overexpression in prostate cancer (53) and nasopharyngeal carcinoma cells (54). The results of Raida et al. show enhanced Id-1 expression and activated ERKs in BMP2-overexpressing MCF7 cells, but it is not clear whether the activated signaling pathway resulted from enhanced Id-1 expression, or the two observed phenomena occurred independently (38). Here, we show that the ERK pathway was activated upon Id-1 FIGURE 6. Id-1 enhances the transcriptional activity of HIF-1a. MCF7 cells stably expressing empty pCI-neo vector (Id-1 , lanes 1-7 ) or pCI-neo-Id-1-HA (Id-1 +, lanes 8-13 ) were subjected to reporter assays as described in Materials and Methods. Cells were transiently transfected with appropriate reporters (HRE-Luc or VEGF promoter-Luc ) and ERK mutants (ERK1KR or ERK2KR, lanes 4-7 and 10-13 ) and harvested 25 h later for reporter assays. Some cells were chemically treated with 100 Amol/L CoCl2 (lane 2) or 100 Amol/L PD98059 (lanes 3 and 9) at 1 h after transfection for 24 h and harvested at 25 h after transfection. Columns, average of a representative experiment done in quadruplicate; bars, SD. Upon statistical analysis with Student’s t test, all lanes showed statistical significance of suppression of reporter activity when compared with Id-1 (lane 8) at the 0.001 level. Lane 2 was not statistically analyzed. Id-1 Enhances Stability and Activity of HIF-1a Mol Cancer Res 2007;5(4). April 2007 325 on July 8, 2017. © 2007 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from overexpression in breast cancer cells as evidenced by increased phosphorylation of ERKs (Fig. 3A) and augmented Egr-1 expression. The critical role of ERK pathway in the regulation of HIF-1a protein stability has been reported previously. The stability of HIF-1a protein is increased in hepatitis B virus X protein– induced Chang liver cells, and PD98059 decreases the hepatitis B virus X protein–induced stability of HIF-1a protein (19). In TetOff–induced HT42 cells, significant amount of HIF-1a protein is expressed under normoxia (55). Although the authors explain their result as PD98059 having no effect on HIF-1a protein stabilization, we disagree with the authors’ interpretation. Their data (Fig. 7A of ref. 55) show that the total amount of induced HIF-1a protein is clearly reduced upon PD98059 treatment, which supports the requirement of active ERK pathway in HIF-1a protein stabilization under normoxia. The Id-1–induced HIF-1a protein was capable of transactivating two HRE-dependent promoters, which required active ERK signaling (Fig. 6). Although ERK phosphorylation does take place, phosphorylation of HIF-1a residues considered central for transactivation activity are not phosphorylated by this pathway (56, 57). Instead, it has been suggested that ERK signaling affects the transactivation activity of p300/CBP by targeting the COOHterminal transactivation domain of CBP, possibly regulating the interaction between p300/CBP and HIF-1a (58, 59). Moreover, such enhanced phosphorylation of CBP by activated ERK pathway may increase its affinity for HIF-1a, therefore enhancing the nuclear translocation of HIF-1a into the nucleus and reducing its presence in the cytoplasm as seen in the inverse relationship in Fig. 7 (top and middle). HIF-1a is a well-known transcriptional regulator of VEGF, the most potent and important angiogenic substance known thus far (60). Furthermore, HIF-1a is overexpressed in many neoplastic tissues (61), not only due to the hypoxic nature of tumors but also due to oncogene activation (60). In this study, we have described the novel mechanism of Id-1 in enhancing the protein stability, nuclear localization, and activity of HIF-1a in human breast cancer cells. Id-1 also induced the protein level of HIF-1a and the in vitro tube formation in human endothelial cells (Figs. 1 and 8). One possible scenario for the Id-1 effect in endothelial cells would be that the augmented angiogenesis is mediated by increased VEGF expression, which in turn is upregulated by augmented HIF-1a protein. According to our model (Id-1 overexpression ! HIF-1a stability ! VEGF induction ! angiogenesis), induced VEGF may act in an autocrine and/or paracrine manner in endothelial cells. Yet, the recent report of Sakurai et al. presents a different model that VEGF-induced HUVEC activation is mediated by Id-1 and Id-3 (33). VEGF induces Id-1 and Id-3 and gives HUVEC induction (VEGF treatment ! Id-1, Id-3 induction ! angiogenesis), but silencing of Id-1 and Id-3 by short hairpin RNA transfection inhibits VEGF-induced angiogenic process of HUVECs (33). However, we do not believe that these two models are mutually exclusive because our Id-1 ! HIF-1a ! VEGF pathway may act as a positive feedback loop in the VEGF ! Id-1 mechanism suggested by Sakurai et al. Because overexpression of Id-1 is sufficient to induce tube formation of HUVECs in both models, it would be intriguing to block the VEGF signaling by adding VEGF-blocking antibodies to the culture media or treat cells with VEGF receptor inhibitors. Our result also implicate both cancer cells and endothelial cells as possible sources of Id-1– induced angiogenic factors: that angiogenic factors released from cancer cells or endothelial cells may act in a paracrine or autocrine matter, respectively. The results of Ling et al. support the paracrine model from the cancer cells that the overexpression of Id-1 in prostate cancer cells promotes angiogenesis through the activation of VEGF (47). In fact, the recent report of Huh et al. show the down-regulation of Id-1 in both mammary tumor and endothelial cells where angiogenesis is blocked by 2-methoxyestradiol treatment (45). Therefore, by understanding FIGURE 7. Id-1 enhances the association of HIF-1a and CBP. 293T cells (2 10 per dish) were seeded in 60-cm dishes and incubated overnight. The cells were transfected with 2 Ag p3XFLAG7.1-HIF-1a (FlagHIF-1a +) and 2 Ag pCI-neo-Id-1-HA (Id-1 +) or corresponding empty vectors (Flag-HIF-1a , Id-1 ) as indicated. After 1 h of transfection, the cells were incubated with 100 Amol/L CoCl2 for 24 h. At 24 h after transfection, some cells were treated with 10 Amol/L MG132 for 1 h and harvested simultaneously at 25 h after transfection. From a single representative experiment of three independent experiments with similar results. Anti-CBP immunoprecipitation was done as described in Materials and Methods. The immunoblots of the immunoprecipitated samples are from an identical membrane: probed first with anti-Flag antibody (IP: CBP, IB: Flag ), stripped, and reprobed with anti-CBP antibody (IP: CBP, IB: CBP ). Anti-VHL immunoprecipitation was done as described in Materials and Methods with the same lysates of the top panel. The immunoblots of the immunoprecipitated samples were from immunoprecipitation done in duplicate and run on two separate gels: 8% SDS-PAGE and probed with anti-Flag antibody (IP: VHL, IB: HIF-1a ) or 12% SDS-PAGE and probed with anti-VHL antibody (IP: VHL, IB: VHL ). Fifty micrograms of whole-cell lysates were analyzed for expression of the indicated proteins by immunoblotting. The five immunoblots were from the identical lysates shown in the immunoprecipitated blots above: CBP (IB: CBP ) and FlagHIF-1a (IB: Flag ) were detected from separate membranes, whereas Id-1 (IB: Id-1 ) and h-actin (IB: b-actin ) blots were from an identical membrane and cut and probed separately. Anti-VHL immunoblot (IB: VHL ) was done with the identical membrane of Id-1 (IB: Id-1 ), stripped, and reprobed with anti-VHL antibody. 3 Unpublished data. Kim et al. Mol Cancer Res 2007;5(4). April 2007 326 on July 8, 2017. © 2007 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from the molecular cross talk between Id-1 and HIF-1a, we not only provide the important implications for tumor angiogenesis but also a valuable target to treat Id-1–overexpressing cancers. Materials and Methods Cell Culture and Hypoxia HUVECs were isolated from freshly obtained human umbilical cords as described (62) and maintained in gelatincoated dish with M199 media containing endothelial cell growth supplement (20 Ag/mL; Sigma, St. Louis, MO), 5 units/mL heparin, and 20% fetal bovine serum. The cells used in this study were from passages 3 to 9. MCF7 cells (ATCC HTB-22) were maintained in RPMI 1640 supplemented with 10% fetal bovine serum, and 293T cells were maintained in DMEM containing 10% fetal bovine serum. For hypoxic stimulation, cells were placed in an anaerobic incubator (Forma Scientific, Marietta, OH) in 1% O2, 5% CO2, and 94% N2 at 37jC, or chemically treated with 100 Amol/L CoCl2 (Sigma). Overexpression of Id-1 Full-length Id-1 cDNA encoding isoform a (NM_002165) in pLXSN retroviral vector was a generous gift from Dr. Pierre-Yves Desprez (Cancer Research Institute, San Francisco, CA) and used as PCR template for cloning. Kozak sequence and hemagglutinin (HA) epitope tag were added to 5¶ and 3¶ ends of Id-1 cDNA, respectively, to generate Id-1-HA by PCR (forward, 5¶-GAAGATCTCCACCATGAAAGTCGCCAGTGGCA-3¶; reverse, 5¶ATAAGAATGCGGCCGCCTAAGCGTAGTCTGGGACGTCGTATGGGTACGACACAAGATGCGATCGT-3¶). The resulting PCR product was cloned into BglII and NotI sites of pShuttle-CMV-IRES-EGFP, which contained IRES-EGFP in NotI and XhoI sites of pShuttle-CMV (Qbiogene, Carlsbad, CA) to generate pShuttle-CMV-Id-1-HA-IRES-EGFP. The sequence of the PCR-cloned Id-1-HAwas confirmed by sequencing. Recombinant IRES-EGFP or Id-1-HA-IRES-EGFP adenoviruses were produced with the AdEasy system (Qbiogene) to express EGFP alone or Id-1-HA and EGFP, respectively. Recombinant Id-1-HA retrovirus was generated by inserting the Id-1-HA from pShuttleCMV-Id-1-HA-IRES-EGFP into the BglII/NotI sites of IRESEGFP-CL (generous gift fromDr. C.H. Park, HanyangUniversity, Seoul, Korea) and transiently transfected into 293gpg retrovirus packaging cell line (63) with LipofectAMINE (Invitrogen, Carlsbad, CA). The resulting Id-1-HA retrovirus expressed EGFP and Id-1-HA. As a negative control, retrovirus generated with an empty IRES-EGFP-CL vector, which encodes EGFP alone, was used. Recombinant Id-1-HA expression vector was generated by inserting the blunt-ended Id-1-HA (BglII/NotI fragment blunted with Klenow fragment) from pShuttle-CMV-Id-1-HA-IRESEGFP into the SmaI site of pCI-neo (Promega, Madison, WI). Transfections were done with FuGENE6 (Roche Molecular Biochemicals, Indianapolis, IN), and stable transfectants harboring empty vector (pCI-neo) or pCI-neo-Id-1-HA were selected and maintained in medium supplemented with G418 (Invitrogen). Reverse Transcription-PCR Total RNA was extracted with TRIZOL (Invitrogen), and reverse transcription-PCR was done with Access RT-PCR System (Promega) according to the manufacturer’s instructions. The thermal profiles consisted of 94jC for 3 min for initial denaturing followed by 30 cycles of 95jC for 1 min, 64jC for 1 min, and 72jC for 1 min. Specific primers used for PCR are as follows: Id-1 (forward, 5¶-TCTTCAAGCCATCCTGTGTGC-3¶; reverse, 5¶-AGCGTAGTCTGGGACGTCGT-3¶), VEGF (forward, 5¶-TCTTCAAGCCATCCTGTGTGC-3¶; reverse, 5¶-CACATTTGTTGTGCTGTAGGAAGC-3¶), HIF-1a (forward, 5¶-TGTAATGCTCCCCTCACCCAACGAA-3¶; reverse, 5¶-CAGGGCTTGCGGAACTGCTTTCTAA-3¶), and glyceraldehyde-3-phosphate dehydrogenase (forward, 5¶-CGGAGTCAACGGATTTGGTCGTAT-3¶; reverse, 5¶-AGCCTTCTCCATGGTTGGTGAAGAC-3¶). Immunoblotting and Immunoprecipitation Cell lysis and immunoblotting were done with buffers and antibodies as described (19). Anti-HIF-1a immunoprecipitation was done as described (19). Anti-CBP or anti-VHL immunoprecipitation was done with 0.5 mg cell lysate and 2 Ag anti-CBP FIGURE 8. Id-1 enhances in vitro tube formation in HUVECs. HUVECs were infected with EGFP alone (Control ) – or EGFP and Id-1-HA (Id-1 ) – expressing retrovirus for 48 h. Cells were incubated under either hypoxic (Hypoxia) or normoxic (Normoxia ) condition. A. Tube formation assay was done as described in Materials and Methods. Some cells were treated with 100 Amol/L PD98059 during the entire 24-h incubation period on Matrigel (Id-1 + PD98059 ). From at least three independent experiments. B. Tube formation was presented as relative values to that of control cells in normoxia (lane 4 ). Columns, average of a representative experiment; bars, SD. ***, P < 0.001, statistical significance of induction of tube formation by Id-1 (lanes 2 and 5 for Hypoxia and Normoxia , respectively; one-way ANOVA and post hoc test using Scheffe). Id-1 Enhances Stability and Activity of HIF-1a Mol Cancer Res 2007;5(4). April 2007 327 on July 8, 2017. © 2007 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from antibody (sc-1211; Santa Cruz Biotechnology, Santa Cruz, CA) or anti-VHL antibody (sc-5575; Santa Cruz Biotechnology), respectively. The resulting immunocomplex was precipitated by adding 40 AL Protein A-Sepharose CL-4B (GE Healthcare, Piscataway, NJ) and detected by immunoblotting with appropriate antibodies. Antibodies against Id-1 (sc-488), VEGF (sc-507), HIF-1a (sc-10790), and Myc (sc-40) were from Santa Cruz Biotechnology. h-Actin (mab1501r) was from Chemicon International (Temecula, CA). Phosphorylated ERK (phospho-specific at T202 and Y204; CS 9101) was from Cell Signaling Technology (Danvers, MA). ERK (61-7400) was from Zymed Laboratories (South San Francisco, CA). Flag was from Sigma. Immunocytochemistry MCF7 stable cells (7.5 10 per chamber) that had been plated the previous day on a four-chamber slide glass (Lab-Tek II Chamber Slide System, Nalge Nunc International, Rochester, NY) were subjected to appropriate treatments for 24 h. The cells were fixed with 4% paraformaldehyde for 30 min and then permeabilized with 0.2% Triton X-100 in PBS for 5 min at room temperature. The cells were incubated in blocking solution of 3% bovine serum albumin in PBS for 1 h and stained with anti-HIF-1a antibody (1:100 dilution) in PBS containing 3% bovine serum albumin overnight, followed by addition of R-phycoerythrin–conjugated anti-rabbit immunoglobulin antibody (1:200 dilution; Sigma) in PBS containing 3% bovine serum albumin. Nuclei were stained with 4¶,6diamidino-2-phenylindole. Stained cells were visualized by fluorescence microscopy (Nikon Instech Co., Kanagawa, Japan). Reporter Gene Assay HRE-Luc reporter, VEGF promoter-Luc reporter, pERK1KR, and pERK2KR were as described previously (64-66). Reporter gene assay was done as described (19). Briefly, MCF7 cells stably expressing empty pCI-neo vector or pCI-neo-Id-1-HA were seeded at 1.5 10 per well in a 12-well plate on the day before transfection and transiently transfected with a reporter construct (50 ng HRE-Luc or 150 ng VEGF promoter-Luc) and a h-galactosidase expression vector (100 ng) in the maintenance medium with FuGENE 6 (Roche Molecular Biochemicals). For cotransfection experiments, plasmids encoding kinase-inactive ERK1/2 were additionally added at 100 ng (low) or 250 ng (high) per well. The total amount of DNAwas kept constant at 500 ng per well by using corresponding empty vector as control filler plasmid DNA. For chemical treatments, cells were treated at 1 h after transfection with 100 Amol/L CoCl2 or 100 Amol/L PD98059 for 24 h. At 25 h after transfection, cells were harvested in reporter lysis buffer (Luciferase Assay System with Reporter Lysis Buffer, Promega), and luciferase activities were measured on a MicroLumat Plus LB96V luminometer (Berthold Technologies, Bad Wildbad, Germany). The reporter activities were calculated after normalization with the transfection control of h-galactosidase activity. Tube Formation AssayTube formation assay was done as described (67). Briefly,HUVECs infected with control or Id-1-HA retrovirus for72 h were seeded on a layer of Matrigel (BD Biosciences,Bedford, MA) in the presence or absence of PD98059 for 24 h.The closed networks of vessel-like tubes were counted under aninverted light microscope. Incomplete networks were excluded. References1. Ferrara N. VEGF and the quest for tumour angiogenesis factors. Nat RevCancer 2002;2:795 –803. 2. Flamme I, Breier G, Risau W. Vascular endothelial growth factor (VEGF) andVEGF receptor 2 (flk-1) are expressed during vasculogenesis and vasculardifferentiation in the quail embryo. Dev Biol 1995;169:699 –712. 3. Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N. Vascularendothelial growth factor is a secreted angiogenic mitogen. Science 1989;246:1306– 9. 4. Shweiki D, Itin A, Soffer D, Keshet E. Vascular endothelial growth factorinduced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature 1992;359:843–5. 5. Forsythe JA, Jiang BH, Iyer NV, et al. Activation of vascular endothelialgrowth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Biol1996;16:4604–13. 6. Salceda S, Caro J. Hypoxia-inducible factor 1a (HIF-1a) protein is rapidlydegraded by the ubiquitin-proteasome system under normoxic conditions. Itsstabilization by hypoxia depends on redox-induced changes. J Biol Chem 1997;272:22642–7. 7. Cockman ME, Masson N, Mole DR, et al. Hypoxia inducible factor-a bindingand ubiquitylation by the von Hippel-Lindau tumor suppressor protein. J BiolChem 2000;275:25733– 41. 8. Tanimoto K, Makino Y, Pereira T, Poellinger L. Mechanism of regulation ofthe hypoxia-inducible factor-1 a by the von Hippel-Lindau tumor suppressorprotein. EMBO J 2000;19:4298– 309. 9. Kallio PJ, Okamoto K, O’Brien S, et al. Signal transduction in hypoxic cells:inducible nuclear translocation and recruitment of the CBP/p300 coactivator bythe hypoxia-inducible factor-1a. EMBO J 1998;17:6573 –86. 10. Arany Z, Huang LE, Eckner R, et al. An essential role for p300/CBP in thecellular response to hypoxia. Proc Natl Acad Sci U S A 1996;93:12969 –73. 11. Carrero P, Okamoto K, Coumailleau P, O’Brien S, Tanaka H, Poellinger L.Redox-regulated recruitment of the transcriptional coactivators CREB-bindingprotein and SRC-1 to hypoxia-inducible factor 1a. Mol Cell Biol 2000;20:402–15. 12. Ebert BL, Bunn HF. Regulation of transcription by hypoxia requires amultiprotein complex that includes hypoxia-inducible factor 1, an adjacenttranscription factor, and p300/CREB binding protein. Mol Cell Biol 1998;18:4089– 96. 13. Ema M, Hirota K, Mimura J, et al. Molecular mechanisms of transcriptionactivation by HLF and HIF1a in response to hypoxia: their stabilization and redoxsignal-induced interaction with CBP/p300. EMBO J 1999;18:1905– 14. 14. Yoo YG, Yeo MG, Kim DK, Park H, Lee MO. Novel function of orphannuclear receptor Nur77 in stabilizing hypoxia-inducible factor-1a. J Biol Chem2004;279:53365–73. 15. Zelzer E, Levy Y, Kahana C, Shilo BZ, Rubinstein M, Cohen B. Insulininduces transcription of target genes through the hypoxia-inducible factor HIF-1a/ARNT. EMBO J 1998;17:5085 –94. 16. Richard DE, Berra E, Pouyssegur J. Nonhypoxic pathway mediates theinduction of hypoxia-inducible factor 1a in vascular smooth muscle cells. J BiolChem 2000;275:26765– 71. 17. Chan DA, Sutphin PD, Denko NC, Giaccia AJ. Role of prolyl hydroxylationin oncogenically stabilized hypoxia-inducible factor-1a. J Biol Chem 2002;277:40112–7. 18. Ravi R, Mookerjee B, Bhujwalla ZM, et al. Regulation of tumorangiogenesis by p53-induced degradation of hypoxia-inducible factor 1a. GenesDev 2000;14:34 –44. 19. Yoo YG, Oh SH, Park ES, et al. Hepatitis B virus X protein enhancestranscriptional activity of hypoxia-inducible factor-1a through activation ofmitogen-activated protein kinase pathway. J Biol Chem 2003;278:39076 –84. 20. Bae SH, Jeong JW, Park JA, et al. Sumoylation increases HIF-1astability and its transcriptional activity. Biochem Biophys Res Commun 2004;324:394 – 400. 21. Haddad JJ. Recombinant human interleukin (IL)-1 h-mediated regulation ofhypoxia-inducible factor-1 a (HIF-1 a) stabilization, nuclear translocation andactivation requires an antioxidant/reactive oxygen species (ROS)-sensitivemechanism. Eur Cytokine Netw 2002;13:250–60.Kim et al. Mol Cancer Res 2007;5(4). April 2007328 on July 8, 2017. © 2007 American Association for Cancer Research.mcr.aacrjournals.orgDownloaded from 22. Jeong JW, Bae MK, Ahn MY, et al. Regulation and destabilization of HIF-1aby ARD1-mediated acetylation. Cell 2002;111:709– 20. 23. Zhou J, Schmid T, Frank R, Brune B. PI3K/Akt is required for heat shockproteins to protect hypoxia-inducible factor 1a from pVHL-independentdegradation. J Biol Chem 2004;279:13506 –13. 24. Isaacs JS, Jung YJ, Neckers L. Aryl hydrocarbon nuclear translocator(ARNT) promotes oxygen-independent stabilization of hypoxia-inducible factor-1a by modulating an Hsp90-dependent regulatory pathway. J Biol Chem 2004;279:16128–35. 25. Yoo YG, Kong G, Lee MO. Metastasis-associated protein 1 enhancesstability of hypoxia-inducible factor-1a protein by recruiting histone deacetylase1. EMBO J 2006;25:1231– 41. 26. Ruzinova MB, Benezra R. Id proteins in development, cell cycle and cancer.Trends Cell Biol 2003;13:410–8. 27. Fong S, Debs RJ, Desprez PY. Id genes and proteins as promising targets incancer therapy. Trends Mol Med 2004;10:387–92. 28. Lyden D, Young AZ, Zagzag D, et al. Id1 and Id3 are required forneurogenesis, angiogenesis and vascularization of tumour xenografts. Nature1999;401:670–7. 29. Lyden D, Hattori K, Dias S, et al. Impaired recruitment of bone-marrow-derived endothelial and hematopoietic precursor cells blocks tumor angiogenesisand growth. Nat Med 2001;7:1194 –201. 30. Li H, Gerald WL, Benezra R. Utilization of bone marrow-derived endothelialcell precursors in spontaneous prostate tumors varies with tumor grade. CancerRes 2004;64:6137 –43. 31. de Candia P, Solit DB, Giri D, et al. Angiogenesis impairment in Id-deficientmice cooperates with an Hsp90 inhibitor to completely suppress HER2/neu-dependent breast tumors. Proc Natl Acad Sci U S A 2003;100:12337–42. 32. Ruzinova MB, Schoer RA, Gerald W, et al. Effect of angiogenesis inhibitionby Id loss and the contribution of bone-marrow-derived endothelial cells inspontaneous murine tumors. Cancer Cell 2003;4:277 –89. 33. Sakurai D, Tsuchiya N, Yamaguchi A, et al. Crucial role of inhibitor of DNAbinding/differentiation in the vascular endothelial growth factor-induced activa-tion and angiogenic processes of human endothelial cells. J Immunol 2004;173:5801–9. 34. Nishiyama K, Takaji K, Kataoka K, et al. Id1 gene transfer confersangiogenic property on fully differentiated endothelial cells and contributes totherapeutic angiogenesis. Circulation 2005;112:2840– 50. 35. Valdimarsdottir G, Goumans MJ, Rosendahl A, et al. Stimulation of Id1expression by bone morphogenetic protein is sufficient and necessary for bonemorphogenetic protein-induced activation of endothelial cells. Circulation 2002;106:2263–70. 36. Langenfeld EM, Langenfeld J. Bone morphogenetic protein-2 stimulatesangiogenesis in developing tumors. Mol Cancer Res 2004;2:141 –9. 37. Pammer J, Reinisch C, Kaun C, Tschachler E, Wojta J. Inhibitors ofdifferentiation/DNA binding proteins Id1 and Id3 are regulated by statins inendothelial cells. Endothelium 2004;11:175 –80. 38. Raida M, Clement JH, Ameri K, Han C, Leek RD, Harris AL. Expression ofbone morphogenetic protein 2 in breast cancer cells inhibits hypoxic cell death.Int J Oncol 2005;26:1465–70. 39. Lee KT, Lee YW, Lee JK, et al. Overexpression of Id-1 is significantlyassociated with tumour angiogenesis in human pancreas cancers. Br J Cancer2004;90:1198– 203. 40. Jang KS, Han HX, Paik SS, Brown PH, Kong G. Id-1 overexpression ininvasive ductal carcinoma cells is significantly associated with intratumoralmicrovessel density in ER-negative/node-positive breast cancer. Cancer Lett2006;244:203–10. 41. Lee TK, Poon RTP, Yuen AP, et al. Regulation of angiogenesis by Id-1through hypoxia-inducible factor-1a-mediated vascular endothelial growth factorup-regulation in hepatocellular carcinoma. Clin Cancer Res 2006;12:6910– 9. 42. Tsuchiya T, Okaji Y, Tsuno NH, et al. Targeting Id1 and Id3 inhibitsperitoneal metastasis of gastric cancer. Cancer Sci 2005;96:784–90. 43. Minn AJ, Gupta GP, Siegel PM, et al. Genes that mediate breast cancermetastasis to lung. Nature 2005;436:518 –24. 44. Fernandez-Garcia NI, Palmer HG, Garcia M, et al. 1a,25-DihydroxyvitaminD3 regulates the expression of Id1 and Id2 genes and the angiogenic phenotype ofhuman colon carcinoma cells. Oncogene 2005;24:6533– 44.45. Huh JI, Calvo A, Charles R, Green JE. Distinct tumor stage-specificinhibitory effects of 2-methoxyestradiol in a breast cancer mouse modelassociated with Id-1 expression. Cancer Res 2006;66:3495–503. 46. Kalas W, Yu JL, Milsom C, et al. Oncogenes and Angiogenesis: down-regulation of thrombospondin-1 in normal fibroblasts exposed to factors fromcancer cells harboring mutant ras. Cancer Res 2005;65:8878 –86. 47. Ling MT, Lau TC, Zhou C, et al. Overexpression of Id-1 in prostate cancercells promotes angiogenesis through the activation of vascular endothelial growthfactor (VEGF). Carcinogenesis 2005;26:1668–76. 48. Semenza GL. Targeting HIF-1 for cancer therapy. Nat Rev Cancer 2003;3:721 –32. 49. Dudley DT, Pang L, Decker SJ, Bridges AJ, Saltiel AR. A synthetic inhibitorof the mitogen-activated protein kinase cascade. Proc Natl Acad Sci U S A 1995;92:7686–9. 50. Folkman J, Haudenschild C. Angiogenesis in vitro . Nature 1980;288:551– 6. 51. Kubota Y, Kleinman HK, Martin GR, Lawley TJ. Role of laminin andbasement membrane in the morphological differentiation of human endothelialcells into capillary-like structures. J Cell Biol 1988;107:1589–98. 52. Montesano R, Orci L, Vassalli P. In vitro rapid organization of endothelialcells into capillary-like networks is promoted by collagen matrices. J Cell Biol1983;97:1648–52. 53. Ling MT, Wang X, Ouyang XS, et al. Activation of MAPK signalingpathway is essential for Id-1 induced serum independent prostate cancer cellgrowth. Oncogene 2002;21:8498–505. 54. Cheung HW, Ling MT, Tsao SW, Wong YC, Wang X. Id-1-induced Raf/MEK pathway activation is essential for its protective role against taxol-induced apoptosis in nasopharyngeal carcinoma cells. Carcinogenesis 2004;25:881 –7. 55. Hofer T, Desbaillets I, Hopfl G, Gassmann M, Wenger RH. Dissectinghypoxia-dependent and hypoxia-independent steps in the HIF-1a activationcascade: implications for HIF-1a gene therapy. FASEB J 2001;15:2715–7. 56. Richard DE, Berra E, Gothie E, Roux D, Pouyssegur J. p42/p44 mitogen-activated protein kinases phosphorylate hypoxia-inducible factor 1a (HIF-1a) andenhance the transcriptional activity of HIF-1. J Biol Chem 1999;274:32631 –7. 57. Gradin K, Takasaki C, Fujii-Kuriyama Y, Sogawa K. The transcriptionalactivation function of the HIF-like factor requires phosphorylation at a conservedthreonine. J Biol Chem 2002;277:23508–14. 58. Janknecht R, Nordheim A. MAP kinase-dependent transcriptional coactiva-tion by Elk-1 and its cofactor CBP. Biochem Biophys Res Commun 1996;228:831 –7. 59. Sang N, Stiehl DP, Bohensky J, Leshchinsky I, Srinivas V, Caro J. MAPKsignaling up-regulates the activity of hypoxia-inducible factors by its effects onp300. J Biol Chem 2003;278:14013–9. 60. Hopfl G, Ogunshola O, Gassmann M. HIFs and tumors-causes andconsequences. Am J Physiol Regul Integr Comp Physiol 2004;286:R608 –23. 61. Zhong H, De Marzo AM, Laughner E, et al. Overexpression of hypoxia-inducible factor 1a in common human cancers and their metastases. Cancer Res1999;59:5830–5. 62. Gimbrone MA, Jr., Cotran RS, Folkman J. Human vascular endothelial cellsin culture. Growth and DNA synthesis. J Cell Biol 1974;60:673–84. 63. Ory DS, Neugeboren BA, Mulligan RC. A stable human-derived packagingcell line for production of high titer retrovirus/vesicular stomatitis virus Gpseudotypes. Proc Natl Acad Sci U S A 1996;93:11400–6. 64. Hur E, Chang KY, Lee E, Lee SK, Park H. Mitogen-activated protein kinasekinase inhibitor PD98059 blocks the trans-activation but not the stabilization orDNA binding ability of hypoxia-inducible factor-1a. Mol Pharmacol 2001;59:1216– 24. 65. Lee MO, Kang HJ, Cho H, Shin EC, Park JH, Kim SJ. Hepatitis B virus Xprotein induced expression of the Nur77 gene. Biochem Biophys Res Commun2001;288:1162– 8. 66. Ema M, Taya S, Yokotani N, Sogawa K, Matsuda Y, Fujii-Kuriyama Y. Anovel bHLH-PAS factor with close sequence similarity to hypoxia-induciblefactor 1a regulates the VEGF expression and is potentially involved in lung andvascular development. Proc Natl Acad Sci U S A 1997;94:4273 –8. 67. Bhagwat SV, Lahdenranta J, Giordano R, Arap W, Pasqualini R, Shapiro LH.CD13/APN is activated by angiogenic signals and is essential for capillary tubeformation. Blood 2001;97:652–9.Id-1 Enhances Stability and Activity of HIF-1a Mol Cancer Res 2007;5(4). April 2007329 on July 8, 2017. © 2007 American Association for Cancer Research.mcr.aacrjournals.orgDownloaded from 2007;5:321-329.Mol Cancer ResHyun-Jun Kim, Heekyoung Chung, Young-Gun Yoo, et al.αof Hypoxia-Inducible Factor-1Growth Factor through Enhancing the Stability and ActivityInhibitor of DNA Binding 1 Activates Vascular Endothelial Updated versionhttp://mcr.aacrjournals.org/content/5/4/321Access the most recent version of this article at: Cited articleshttp://mcr.aacrjournals.org/content/5/4/321.full.html#ref-list-1This article cites 67 articles, 44 of which you can access for free at: Citing articles/content/5/4/321.full.html#related-urlsThis article has been cited by 4 HighWire-hosted articles. Access the articles at: E-mail alertsrelated to this article or journal.Sign up to receive free email-alerts SubscriptionsReprints [email protected] atTo order reprints of this article or to subscribe to the journal, contact the AACR Publications [email protected] atTo request permission to re-use all or part of this article, contact the AACR Publications on July 8, 2017. © 2007 American Association for Cancer Research.mcr.aacrjournals.orgDownloaded from